pgem®-t easy vector systems technical manual  (Promega)

Journal: Scientific Reports

Article Title: Integron gene cassettes harboring novel variants of d -alanine- d -alanine ligase confer high-level resistance to d -cycloserine

doi: 10.1038/s41598-020-77377-4

Figure Lengend Snippet: Features of the ddl gene cassettes, their closest homologues and the phylogenetic analysis . ( A ) Genetic organisation of 2024 bp inserts in the pGEM-T Easy vector; ( B ) Comparison of putative attI sequence preceding ddl in the inserts with the putative attI of the integron of T. denticola ATCC 35405 . The putative integrase binding sites S1 and S2 as well as DR1 and DR2 are also shown. The putative recombination point G↓TT and the putative transcription start site (TSS) located at the 3ʹ-end of attI are also shown. ( C ) Comparison of partial sequence of attC detected at the 3ʹ-end of the 2024 bp insert with a typical complete attC -associated with Tde1837 of T. denticola integron . ( D ) The percentage identity of the flanking sequence of ddl6/ddl7 (40 bp upstream and 29 bp downstream) with their closest homologue, ddl(GC) located on a 5699 bp contig of T. pedis B683 genome (GenBank accession: NZ_AOTN01000179). The putative core sites of the attC (R″ and L″), the simple integrase binding site (S1) are shown. The recombination points located on S1 and core site, R′ of the attC located upstream of ddl(GC) ( attC HDIG ) are marked with the blue arrows. The binding sites for the primers, TDIF and MASRS2, used for amplification of the integrons and associated gene cassettes are also shown. The start codons (ATG) as well as the S1, R′, R″, L″ sites are in bold. ( E ) Phylogenetic tree of ddl6 , ddl7 and ddl(GC) along with the ddl s of different strains of T. denticola and other Treponema species. The ddlA of E. coli was used as an outgroup. The evolutionary relationship was inferred using the Neighbour-Joining method . The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches. Evolutionary analyses were conducted in MEGA X .

Article Snippet: The expected size PCR products were purified by gel extraction using QIAquick Gel Extraction Kit (Qiagen, Germany) and A-tailed following the protocol for cloning blunt-ended PCR products described in pGEM-T Easy Vector Systems Technical Manual (Promega, UK).

Techniques: Plasmid Preparation, Sequencing, Binding Assay, Amplification

Journal: Scientific Reports

Article Title: Integron gene cassettes harboring novel variants of d -alanine- d -alanine ligase confer high-level resistance to d -cycloserine

doi: 10.1038/s41598-020-77377-4

Figure Lengend Snippet: The genetic arrangement of 4421 bp pGEM-T Easy insert carrying ddl7 , full length intI and another partial ORF encoding a hypothetical protein. The primers used to amplify this product are shown with small arrows. The genetic arrangements of the closest homologues including T. denticola H-22 (GenBank accession: AGDV01000005:c23656-19631), T. denticola ATCC35405 (Genbank accession: AE017226:1873126-1877351) and T. denticola US-Trep acdtB (GenBank accession: AGEB01000014.1:3405-5167) have also been shown. The most variable region among the strains was found to be the sequence between the ORF for a hypothetical protein (Hyp. Protein in the top row) and intI .

Article Snippet: The expected size PCR products were purified by gel extraction using QIAquick Gel Extraction Kit (Qiagen, Germany) and A-tailed following the protocol for cloning blunt-ended PCR products described in pGEM-T Easy Vector Systems Technical Manual (Promega, UK).

Techniques: Sequencing

Journal: Microorganisms

Article Title: Sulfur Oxygenase Reductase (Sor) in the Moderately Thermoacidophilic Leaching Bacteria: Studies in Sulfobacillus thermosulfidooxidans and Acidithiobacillus caldus

doi: 10.3390/microorganisms3040707

Figure Lengend Snippet: Polymerase chain reaction (PCR) primers used in this study.

Article Snippet: T7 , taatacgactcactataggg , Promoterregions , 158 bp , Promega® pGEM-T vector manual.

Techniques: Polymerase Chain Reaction, Sequencing, Amplification, Plasmid Preparation